EyeWorld is the official news magazine of the American Society of Cataract & Refractive Surgery.
Issue link: https://digital.eyeworld.org/i/115557
28 EW NEWS & OPINION March 2013 Insights TAATTTAGTAAGTTACTTAGAAGT … Say what? by J.C. Noreika, M.D., M.B.A. T he title? More on that later. Since its inaugural in 1975, the annual meeting of the American Society of Cataract & Refractive Surgery nee the American Intraany persistent corneal ulceration where a steroid has been used or is in use. Fungal culture should be taken when appropriate. BRIEF SUMMARY OF PRESCRIBING INFORMATION INDICATIONS AND USAGE Ocular Surgery DUREZOL® (difuprednate ophthalmic emulsion) 0.05%, a topical corticosteroid, is indicated for the treatment of infammation and pain associated with ocular surgery. Endogenous Anterior Uveitis DUREZOL® Emulsion is also indicated for the treatment of endogenous anterior uveitis. DOSAGE AND ADMINISTRATION Ocular Surgery Instill one drop into the conjunctival sac of the afected eye 4 times daily beginning 24 hours after surgery and continuing throughout the frst 2 weeks of the postoperative period, followed by 2 times daily for a week and then a taper based on the response. Endogenous Anterior Uveitis Instill one drop into the conjunctival sac of the afected eye 4 times daily for 14 days followed by tapering as clinically indicated. DOSAGE FORMS AND STRENGTHS DUREZOL® Emulsion contains 0.05% difuprednate as a sterile preserved emulsion for topical ophthalmic administration. CONTRAINDICATIONS The use of DUREZOL® Emulsion, as with other ophthalmic corticosteroids, is contraindicated in most active viral diseases of the cornea and conjunctiva including epithelial herpes simplex keratitis (dendritic keratitis), vaccinia, and varicella, and also in mycobacterial infection of the eye and fungal disease of ocular structures. WARNINGS AND PRECAUTIONS IOP Increase Prolonged use of corticosteroids may result in glaucoma with damage to the optic nerve, defects in visual acuity and felds of vision. Steroids should be used with caution in the presence of glaucoma. If this product is used for 10 days or longer, intraocular pressure should be monitored. Cataracts Use of corticosteroids may result in posterior subcapsular cataract formation. Delayed Healing The use of steroids after cataract surgery may delay healing and increase the incidence of bleb formation. In those diseases causing thinning of the cornea or sclera, perforations have been known to occur with the use of topical steroids. The initial prescription and renewal of the medication order beyond 28 days should be made by a physician only after examination of the patient with the aid of magnifcation such as slit lamp biomicroscopy and, where appropriate, fuorescein staining. Bacterial Infections Prolonged use of corticosteroids may suppress the host response and thus increase the hazard of secondary ocular infections. In acute purulent conditions, steroids may mask infection or enhance existing infection. If signs and symptoms fail to improve after 2 days, the patient should be reevaluated. Viral Infections Employment of a corticosteroid medication in the treatment of patients with a history of herpes simplex requires great caution. Use of ocular steroids may prolong the course and may exacerbate the severity of many viral infections of the eye (including herpes simplex). Fungal Infections Fungal infections of the cornea are particularly prone to develop coincidentally with long-term local steroid application. Fungus invasion must be considered in Topical Ophthalmic Use Only DUREZOL® Emulsion is not indicated for intraocular administration. Contact Lens Wear DUREZOL® Emulsion should not be instilled while wearing contact lenses. Remove contact lenses prior to instillation of DUREZOL® Emulsion. The preservative in DUREZOL® Emulsion may be absorbed by soft contact lenses. Lenses may be reinserted after 10 minutes following administration of DUREZOL® Emulsion. ADVERSE REACTIONS Adverse reactions associated with ophthalmic steroids include elevated intraocular pressure, which may be associated with optic nerve damage, visual acuity and feld defects; posterior subcapsular cataract formation; secondary ocular infection from pathogens including herpes simplex, and perforation of the globe where there is thinning of the cornea or sclera. Ocular Surgery Ocular adverse reactions occurring in 5-15% of subjects in clinical studies with DUREZOL® Emulsion included corneal edema, ciliary and conjunctival hyperemia, eye pain, photophobia, posterior capsule opacifcation, anterior chamber cells, anterior chamber fare, conjunctival edema, and blepharitis. Other ocular adverse reactions occurring in 1-5% of subjects included reduced visual acuity, punctate keratitis, eye infammation, and iritis. Ocular adverse reactions occurring in < 1% of subjects included application site discomfort or irritation, corneal pigmentation and striae, episcleritis, eye pruritis, eyelid irritation and crusting, foreign body sensation, increased lacrimation, macular edema, sclera hyperemia, and uveitis. Most of these reactions may have been the consequence of the surgical procedure. Endogenous Anterior Uveitis A total of 200 subjects participated in the clinical trials for endogenous anterior uveitis, of which 106 were exposed to DUREZOL® Emulsion. The most common adverse reactions of those exposed to DUREZOL® Emulsion occurring in 5-10% of subjects included blurred vision, eye irritation, eye pain, headache, increased IOP, iritis, limbal and conjunctival hyperemia, punctate keratitis, and uveitis. Adverse reactions occurring in 2-5% of subjects included anterior chamber fare, corneal edema, dry eye, iridocyclitis, photophobia, and reduced visual acuity. USE IN SPECIFIC POPULATIONS Pregnancy Teratogenic Efects Pregnancy Category C. Difuprednate has been shown to be embryotoxic (decrease in embryonic body weight and a delay in embryonic ossifcation) and teratogenic (cleft palate and skeletal) anomalies when administered subcutaneously to rabbits during organogenesis at a dose of 1–10 mcg/kg/day. The no-observed-efect-level (NOEL) for these efects was 1 mcg/kg/day, and 10 mcg/kg/day was considered to be a teratogenic dose that was concurrently found in the toxic dose range for fetuses and pregnant females. Treatment of rats with 10 mcg/kg/day subcutaneously during organogenesis did not result in any reproductive toxicity, nor was it maternally toxic. At 100 mcg/kg/day after subcutaneous administration in rats, there was a decrease in fetal weights and delay in ossifcation, and efects on weight gain in the pregnant females. It is difcult to extrapolate these doses of difuprednate to maximum daily human doses of DUREZOL® Emulsion, since DUREZOL® Emulsion is administered topically with minimal systemic absorption, and difuprednate blood levels were not measured in the reproductive animal studies. However, since use of difuprednate during human pregnancy has not been evaluated and cannot rule out the possibility of harm, DUREZOL® Emulsion should be used during pregnancy only if the potential beneft justifes the potential risk to the embryo or fetus. Ocular Implant Society has enlightened the international ophthalmic community with avant-garde scientific and technologic presentations. Congruent with the symposium, Dr. Ken Hoffer's vision, and ASCRS' core Nursing Mothers It is not known whether topical ophthalmic administration of corticosteroids could result in sufcient systemic absorption to produce detectable quantities in breast milk. Systemically administered corticosteroids appear in human milk and could suppress growth, interfere with endogenous corticosteroid production, or cause other untoward efects. Caution should be exercised when DUREZOL® Emulsion is administered to a nursing woman. Pediatric Use Safety and efectiveness in pediatric patients have not been established. Geriatric Use No overall diferences in safety or efectiveness have been observed between elderly and younger patients. Nonclinical Toxicology Carcinogenesis, Mutagenesis, and Impairment of Fertility Difuprednate was not genotoxic in vitro in the Ames test, and in cultured mammalian cells CHL/IU (a fbroblastic cell line derived from the lungs of newborn female Chinese hamsters). An in vivo micronucleus test of difuprednate in mice was also negative. Treatment of male and female rats with subcutaneous difuprednate up to 10 mcg/kg/day prior to and during mating did not impair fertility in either gender. Long term studies have not been conducted to evaluate the carcinogenic potential of difuprednate. Animal Toxicology and/or Pharmacology In multiple studies performed in rodents and non-rodents, subchronic and chronic toxicity tests of difuprednate showed systemic efects such as suppression of body weight gain; a decrease in lymphocyte count; atrophy of the lymphatic glands and adrenal gland; and for local efects, thinning of the skin; all of which were due to the pharmacologic action of the molecule and are well known glucocorticosteroid efects. Most, if not all of these efects were reversible after drug withdrawal. The NOEL for the subchronic and chronic toxicity tests were consistent between species and ranged from 1–1.25 mcg/kg/day. PATIENT COUNSELING INFORMATION Risk of Contamination This product is sterile when packaged. Patients should be advised not to allow the dropper tip to touch any surface, as this may contaminate the emulsion. Use of the same bottle for both eyes is not recommended with topical eye drops that are used in association with surgery. Risk of Secondary Infection If pain develops, or if redness, itching, or infammation becomes aggravated, the patient should be advised to consult a physician. Contact Lens Wear DUREZOL® Emulsion should not be instilled while wearing contact lenses. Patients should be advised to remove contact lenses prior to instillation of DUREZOL® Emulsion. The preservative in DUREZOL® Emulsion may be absorbed by soft contact lenses. Lenses may be reinserted after 10 minutes following administration of DUREZOL® Emulsion. Revised: June 2012 U.S. Patent 6,114,319 Manufactured For Alcon Laboratories, Inc. 6201 South Freeway Fort Worth, Texas 76134 USA 1-800-757-9195 MedInfo@AlconLabs.com Manufactured By: Catalent Pharma Solutions Woodstock, IL 60098 ©2012 Novartis 6/12 DUR12020JAD mission, it is fitting to review Regenesis: How Synthetic Biology Will Reinvent Nature and Ourselves (Basic Books, New York, 2012). This dense, sometimes difficult book explains the concepts, promises, and threats of synthetic biology, a branch of biogenetic engineering whose subsets include promising arenas like pharmacogenomics and biofuels. Regardless of one's penchant toward nucleotide sorcery, this genie is out of the bottle. George Church is a professor of genetics at Harvard Medical School, founder of the Personal Genome Project, and winner of the Franklin Institute's Bower Award and Prize for Achievement in Science. Predictably, the press glommed on to sensationalistic snippets from his book. The preposterous idea of retro-engineering a Neanderthal utilizing the uterus of "an extremely adventurous female human" as the anatomic platform is but one example. Shocking? Surely. Important? Not really. California researchers Stanley Cohen and Herbert Boyer gave birth to genetic engineering in 1972. Their work on plasmids only replicated what nature had done more elegantly in viruses called bacteriophages. In the ensuing 40 years, advances in reading, duplicating, splicing, and producing genomic material have been made. Accuracy has increased; time and cost have exponentially decreased. The book is cleverly organized. The first six chapters use geologic epochs from the Late Hadean some 3.8 billion years ago to the Pleistocene when Homo sapiens emerged dominant over other competing species like the Neanderthal. The final chapters cover six industrial revolutions that have secured man's dominance. Thematically linked to a geologic era, early chapters cover nucleotide biochemistry. Chicken and egg arguments arise: DNA requires proteinaceous enzymes and proteinaceous enzymes require DNA. Which came first? According to Church, catalytic RNA called ribozymes made life possible. He has an intense interest in the "mirror world" in which the handedness or chirality of genetic molecules are reversed. He postulates that a mirror organism would naturally resist known viruses and even cancers.